1. Opening an account
Complete the Sequencing Request Form
Press “submit”, it will be sent to us by email.
You will receive a password and user name to access Nanuq, our web application. You will then be able to submit your samples online.
If any of the samples to be sequenced in your project are directly or indirectly obtained from human subjects (e.g. PCR product from human genomic DNA), please include a copy of your institution’s ethics review committee’s approval letter.
We only accept these formats:
PCR «strip» tubes
PCR 96-well plates
If more than 48 samples, you must use the 96-wells plate.
We suggest the following products:
PCR «strip» tubes: UltiDent Scientific, 0,2 ml thin-walled 12 tube and domed cap strips, catalog # 185-AB-0266
PCR 96-well plates: Corning, Thermowell® GOLD 96 Well Clear Polypropylene PCR Microplate, Half Skirt, Nonsterile, Product #3753
Sealers for plate: Applied Biosystems, MicroAmp Clear Adhesive Films, catalog #: 4306311
3. Samples and primers organization
- PCR «strip» tubes: regroup all samples (plasmids or PCR products) one after the other. The tubes must be properly labelled with the corresponding well ID on the Sample Submission Form. Example: A01, A02,A03…
The same method is applicable to primers; they must be properly labelled and aliquoted in PCR strip tubes in the same order as their associated DNA samples.
- PCR 96-well plates: regroup all samples (plasmids or PCR products) one after the other starting at well A01 and following the plate order which is A01 to A12, B01 to B12 and so on. The primers must be aliquoted in the same order as their associated DNA samples, on the same plate in the lower rows if there is enough space or in another properly labeled plate
- If 48 samples or more have to be sequenced with the same primer, you can provide only one tube of primer for these samples. (10 μl of primer/sample).
- If you need to sequence 2 to 47 samples with the same primer, you must provide as many tubes (or wells) of primers as you have samples to be sequenced with this primer (10 μl of primer/sample).
- If you need to sequence one sample with more than one primer, this sample must be aliquoted in as many tubes (or wells) as you have different primers.
- Samples and primers must be organized in exactly the same positions as indicated in your Sample Submission Form.
- Be careful to correctly seal your plates or cap your tubes. (Do not use parafilm or tape). Clearly label your samples on each tube with well ID number (A1, A2…)
Volume and concentration required for sequencing:
|
Volume |
Concentration |
||
| Unpurified PCR* |
20 μl |
Lengh of PCR product |
Quantity |
| Purified PCR |
5 μl minimum |
100-200 bp 200-500 bp 500-1000 bp 1000-2000 bp >2000 bp |
0.5-1.5 ng 1.5-5 ng 2-10 ng 5-20 ng 20-50 ng |
| Plasmid DNA or phage ** |
5 μl minimum |
100-500 ng/μl |
|
| BAC/PAC End sequencing** |
20 μl minimum |
500 ng/μl minimum |
|
* We offer a service to purify your PCR products to remove unincorporated dNTPs and unused PCR primers.
**We also have a service of plasmid DNA extraction in 96-well format only from fresh colonies or glycerol stocks (See section 5).
- PCR products that ran on a gel must be accompanied by an agarose gel picture of the products.
If you wish to use our PCR purification service, you must provide a PCR product with only one amplification product (only one band on the gel) because an additional amplification product cannot be eliminated with our purification procedure.
PCR products less than 100 bp cannot be sequenced.
- For Plasmid DNA, be careful not to leave any traces of Phenol/ Chloroform or Ethanol. Do not resuspend DNA in EDTA. Use 10 mM Tris, pH 8 or water.
It is very important to verify the quality and quantity of your sample (an OD260/OD280 ratio between 1.9 and 1.7)
DNA Extraction Kits from established brand names give very good results if theirs protocols are adequately followed.
Important: It is your responsibility to provide good quality samples in sufficient amounts.
5. Plasmid DNA extraction from bacterial clones
A service of plasmid DNA extraction from fresh colonies or glycerol stocks is offered in 96-well format only. If a 96-well plate cannot be filled, the partial plate can be done at the cost of a full plate.
Clones can be submitted in two ways: as fresh colonies grown on an agar Petri dish for about 16 hours or as frozen glycerol stocks. All fresh colonies must be sent to our laboratory before Thursday noon. In which case we will prepare glycerol stocks of each sample in a 96-well plate.
The glycerol stock plates must be sent in enough dry ice so that the clones remain frozen until reception.
If you are submitting glycerol stocks requiring more than one antibiotic, you must organize your submission such that all the samples requiring the same antibiotic are grouped together.
All clones submitted or prepared by us will be kept for a limited period of 30 days after which they will be disposed of. All samples you wish to keep must be retrieved within this time period. If you are unable to pick them up, you must provide us with a FedEx number or the equivalent, as we will not defray the cost of transportation.
Concentration and volume required per sequencing sample:
|
Volume |
Concentration |
|
| Primer |
10 μl |
5 μM |
The Sequencing Plateform provides the following standard set of common primers free of charge :
| T7 | 5’ – TAATACGACTCACTATAGGG – 3’ |
| T3 | 5’ – AATTAACCCTCACTAAAGGG – 3’ |
| SP6 | 5’ – TATTTAGGTGACACTATAG – 3’ |
| M13 forward | 5’ – GTAAAACGACGGCCAGT – 3’ |
| M13 reverse | 5’ – GGAAACAGCTATGACCATG – 3’ |
| BGH reverse | 5’ – TAGAAGGCACAGTCGAGG – 3’ |
| T7 terminator | 5’ – GCTAGTTATTGCTCAGCGG – 3’ |
Resulting sequences are only clearly readable 30 to 60 bases from the 3’ end of the primer.
Good quality template provided in sufficient amount can produce up to 800 bases of good quality sequence.
PCR products can usually be sequenced using one of the two PCR primers.
It is your responsibility to determine which primers are required to sequence your samples.
The design of the sequencing primer is essential for good results:
-
- Primer length should be between 18 and 24 bases.
- G/C ratio should be 40 to 60%.
- Primer annealing temperature must be superior to 50°C.
- Avoid designing primers upstream of homo or heteropolymeric regions (A, C, G or T repeats) because they are extremely difficult to sequence.
We recommend using the following web site for primer design:
http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi
All DNA and bacterial clone sequencing samples must be submitted on-line via Nanuq, our web application, once you have opened an account.
PDF] Guide for Online Submission of Samples
The samples can be sent by mail or delivered in person between 9:00 A.M. and 5:00 P.M, Monday to Friday.
Samples should be addressed to:
Corine Zotti
McGill University and Genome Quebec
Innovation Centre
740, Docteur Penfield avenue,
Room 7300
Montreal, QC H3A 1A4
Phone: 514-398-3311, ext. : 00522
Fax: 514-398-1795
- You have to print the Way Bill from the submission step and add it to your package.
- We are not responsible for samples that arrive in damaged tubes, plates or strip tubes, or that have evaporated. Nor are we responsible for shipping delays or delays resulting from mislabelled samples.
- All the samples are kept at 4°C for a maximum of two weeks after sequencing. Due to storage constraints, unclaimed samples will be discarded.
- All the results are directly available on our Web application Nanuq. You will be able to visualize the chromatograms or the texts (format FASTA or GenBank) and download them.
- Once downloaded, you can see them with Chromas. A free software version for PCs is available at this adress:
http://www.technelysium.com.au/chromas.html
- All sequences are available on Nanuq for a minimum of one year. After this time, they are archived and can be made available upon demand. Customers can request us to remove their data from Nanuq at any given time.
- We will do our best to process your samples within 2 to 4 working days following the date of reception. However, it can vary depending on the sequencing demand.
- It is indispensable that our guidelines are carefully followed to avoid any delays with the processing of your samples.
- An automatic message will be sent to you when your results are available on Nanuq.
- Small PCR products (150 bp to 250 bp) give sequences with lower average quality scores because of saturation (the smaller the fragment, the more intense the reads) and the compression of bases that occurs at the beginning of all sequences. This is due to the 3730’s capillary electrophoresis technology.
- Samples of good quality with recommended concentrations can usually produce up to 800 bases of good quality sequence.
If you have any questions about your results, do not to hesitate to contact us at: [email protected]
Frequently Asked Questions
Samples submission
- How should I physically organise my samples and/or primers when I send them to the Sequencing Service?
- What quantity/concentration of DNA should I provide for sequencing?
- What quantity/concentration of primer should I provide for sequencing?
- What are the primers provided by the sequencing service?
- Which form should I choose when I submit my samples via Nanuq (step 1 of the submission)?
Results
- Once my samples have been received and accepted by the sequencing service how long does it take to see my sequences on Nanuq?
- How can I visualize and analyse my sequences?
- What length should I expect from the sequences?
- What can I do if my sequencing results are of poor quality?
- The text version of the sequence from Nanuq is different than the chromatogram. Why?
Billing
- Should I give a purchase order number or a credit card number when I submit my samples?
- Who should I send my payment to for the Sequencing Service?
Nanuq
Which Internet browsers are compatible with Nanuq?
Important :
It is strongly recommended to read the forms guidelines documents to avoid any delay in the treatment of your request.
If your samples have been directly or indirectly obtained from human subjects, please include a copy of your institution’s ethics review committee’s approval.
Sequencing Request Form (Opening an Account / Creating New Project)
- [PDF] Sequencing Request Form
Sample Submission Request Form
The Sample submission forms must, without fail, be uploaded through the Web application.
- [PDF] Sample Submission Form Guidelines
Academic Price List
Prices do not include taxes (GST/PST). Canadian researchers outside Quebec do not pay PST tax. Neither tax applies to researchers outside Canada. These prices are for Canadian academic laboratories only.
| Plasmid DNA extractions in a 96 well plate | 96.00 $ |
| DNA sequencing reaction | 3.49 $ |
| BAC or PAC end sequencing reaction | 5.79 $ |
| BAC or PAC sequencing | |
| BAC large prep | 200.00 $ |
| Construction of a BAC fragments library | 200.00 $ |
Prices are subject to change without notice. Commercial prices available upon request.
Please note that if sequencing fails, we will repeat the reactions on a limited number of samples at your request. If we determine that the reactions failed due to a problem with the equipment, the sequencing reaction kit or human error, the reactions will be repeated at no cost. Otherwise, failed reactions due to poor template quality are the responsibility of the client.
Billing Policy
Projects that last no longer than 6 months will be invoiced at the end of the project however those that last longer will be invoiced at regular intervals. In either case, please provide the billing information on the Sequencing Request Form
Payments can only be made by cheque or credit card. A purchase order (PO), requisition, or account number can be added to your invoice upon your request. The cheque must be made to the order of Genome Quebec and sent to :
Genome Quebec
630, boulevard René Lévesque, suite 2660,
Montréal (Québec) Canada
H3B 1S6